Part:BBa_K1680016:Design
pRS316 yeast shuttle vector with Biobrick MCS
- 10INCOMPATIBLE WITH RFC[10]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 2040
Illegal XbaI site found at 2025
Illegal SpeI site found at 2017
Illegal PstI site found at 2003 - 12INCOMPATIBLE WITH RFC[12]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 2040
Illegal SpeI site found at 2017
Illegal PstI site found at 2003
Illegal NotI site found at 2008
Illegal NotI site found at 2032 - 21INCOMPATIBLE WITH RFC[21]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 2040 - 23INCOMPATIBLE WITH RFC[23]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 2040
Illegal XbaI site found at 2025
Illegal SpeI site found at 2017
Illegal PstI site found at 2003 - 25INCOMPATIBLE WITH RFC[25]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 2040
Illegal XbaI site found at 2025
Illegal SpeI site found at 2017
Illegal PstI site found at 2003
Illegal NgoMIV site found at 1668 - 1000INCOMPATIBLE WITH RFC[1000]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal BsaI site found at 1079
Illegal BsaI.rc site found at 3414
Illegal SapI site found at 2331
Illegal SapI site found at 4435
Illegal SapI.rc site found at 926
Design Notes
This part is derived from the pRS316 vector (Sikorski 1989). It is mutagenised to be compatible with RFC10 and the wild type MCS was switched for a RFC10 MCS. The biobrick MCS is flanked by ApaI (Prefix) and SacI (Suffix) restriction sites. These can be used together with either EcoRI or PstI site to introduce a promoter or terminator stably into the vector without disturbing the RFC10 standard.
Sequence of the new RFC10 MCS:
GGGCCCACGTGAATTCGCGGCCGCTTCTAGAGTACTAGTAGCGGCCGCTGCAGACGTGAGCTC
Source
Derived from pRS316 Part:BBa_K950011 (Sikorski 1989).
References
Sikorski, Robert S., and Philip Hieter. "A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae." Genetics 122.1 (1989): 19-27.